Buchn_aphi1_0361 - Buchnera aphidicola pre-tmRNA, version 1 {APS}

[Preceding] [Next] in database
Buchnera aphidicola pre-tmRNA, version 1 {APS}:


    .   10    .   20    .   30    .   40    .   50
GGGGCUGUUUUUGGAUUUGACAAAAUUAUCAACAAAGUAAAGUGCAUGCC
GAGGAACGGUUUGCCUCGAUAAAAGCCGUAAAAAAAUAAUUGCAAAUAAU
AAACAAAACUACGCUUUAGCAGCUUAAAAAACUGAAUAAAGCCCUUCCUU
CUUAUCCUCCUUCUCUUAGGAUGAGAAAACAGGAAGGUCAGAAAAAGAGA
AAAACGUGGAUAUCAAGCUUGACGAUAACACGAAGUAGUUUUUUCAAGCU
AUAUACCUAAUAUGUGUUUUUCCAAAUUAGGUAAUGAAUUCAAUAAAGAA
AAAACUAAGCAUGUAGGGCUUUAUUAGUAGAAAUUUUGGACGCGGGUUCG
AAUCCCGCCAGCUCCAaaa

Mature tmRNA has 3-prime CCA tail;

Proteolysis Tag: (A)ANNKQNYALAA*
Reading Frame (underlined): nt 92-127

Taxonomy: Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae

Sequencing:
Buchnera aphidicola str. APS (Acyrthosiphon pisum) {host: Acyrthosiphon pisum (pea aphid)}, nt 202977-202609 of BA000003.2 (and nt 202977-202609 of BD061520.1) {Patent: JP 2001292771-A 1 23-OCT-2001} (and nt 202977-202609 of AR409405.1) {Patent: US 6632935-A 1 14-OCT-2003} (and nt 202977-202609 of NC_002528.1) [Ref 1];
uncultured bacterium {from Acyrthosiphon pisum (pea aphid) ApHL3LD third instar nymph head EST library}, nt 1-290 of CN752701.1 (and nt 1-303 of CN750153.1) {here CORRECTED} (and nt 1-304 of CN753166.1) {here CORRECTED} {3-prime end in purine-rich site of oligo-dT priming} [Ref 2];
uncultured bacterium {from Acyrthosiphon pisum (pea aphid) ID0AFF adult parthenogenetic females digestive tract EST library}, nt 1-304 of DV739631.1 {here CORRECTED} (and nt 1-303 of DV741509.1) {here CORRECTED} {3-prime end in purine-rich site of oligo-dT priming} [Ref 3];
uncultured bacterium {from Acyrthosiphon pisum (pea aphid) ApHL3SD third instar nymph head EST library}, nt 1-105 of DY230073.1 (and nt 1-104 of DY229286.1) {resume region in purine-rich site of oligo-dT priming} [Ref 3]

Identification: [Ref 4] in NC_002528

Reference:
1. Shigenobu et al (2000) Nature 407:81-86
2. Hunter et al (2004) Unpublished
3. Stern et al (2005) Unpublished
4. K Williams (6-Oct-2000)

Posted: 2-Jan-2001

tmRNA Website ID: Buchn_aphi1_0361

[Preceding] [Next] in database