Bacil_anthr_0488 - Bacillus anthracis tmRNA

[Preceding] [Next] in database
Bacillus anthracis tmRNA:


    .   10    .   20    .   30    .   40    .   50
GGGGACGUUACGGAUUCGACAGGGAUAGUUCGAGCUUAGGUUGCGAGUCG
AGGGGAUCGGCCUCGUUAAAACGUCAAAGCCUAUAAUUGGCAAACAAAAC
AAUCUUUCUUUAGCUGCUUAAUUGCACUAAAGGUUCCUCCCUCCAUCGUC
CAUGUGGUAGGGUAAGGGACUCAAACUAAGUGGACUACGCCGGAGUUCGC
CGUCUGAGGACAAAGGAAGAGAACAACCAGACUAGCAACUUGGAAGCCUG
UCGAUAGGCCGAAGAGUUCGCGAAAUGCUAAUAUAUCGACUACACUCGUA
GAAGCUUAAGUGCCGAUAUUUUUGGACGUGGGUUCGACUCCCACCGUCUC
CACCA

{NOTE: Identical to B. cereus tmRNA version 1 and B. thuringiensis tmRNA version 1}

Proteolysis Tag: (A)GKQNNLSLAA*
Reading Frame (underlined): nt 89-121

Taxonomy: Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae

Sequencing:
Bacillus anthracis str. A2012, nt 176409-176055 of AAAC01000001.1 (and nt 176409-176055 of NZ_AAAC02000001.1) [Ref 1];
Bacillus anthracis str. Ames, nt 4834737-4834383 of AE016879.1 (and nt 4834737-4834383 of NC_003997.3) [Ref 2];
Bacillus anthracis str. Kruger B, nt 30182-29828 of AAEQ01000042.1 (and nt 30182-29828 of NZ_AAEQ01000042.1) [Ref 3];
Bacillus anthracis str. Western North America USA6153, nt 105304-105658 of AAER01000034.1 (and nt 105304-105658 of NZ_AAER01000034.1) [Ref 3];
Bacillus anthracis str. 'Ames Ancestor', nt 4834863-4834509 of AE017334.2 (and nt 4834863-4834509 of NC_007530.2) [Ref 3];
Bacillus anthracis str. Sterne, nt 4836072-4835718 of AE017225.1 (and nt 4836072-4835718 of NC_005945.1) [Ref 4];
Bacillus anthracis str. Australia 94, nt 28815-28461 of AAES01000020.1 (and nt 28815-28461 of NZ_AAES01000020.1) [Ref 3];
Bacillus anthracis str. CNEVA-9066, nt 224470-224824 of AAEN01000018.1 (and nt 224470-224824 of NZ_AAEN01000018.1) [Ref 3];
Bacillus anthracis str. A1055, nt 224535-224889 of AAEO01000027.1 (and nt 224535-224889 of NZ_AAEO01000027.1) [Ref 3];
Bacillus anthracis str. A1055, nt 53-407 of AAEP01000006.1 (and nt 53-407 of NZ_AAEP01000006.1) [Ref 3]

Identification: [Ref 5] in A2012 sequence data at TIGR

Reference:
1. Read et al (2002) Science 296:2028-33
2. Read et al (2003) Nature 423:81-6
3. Ravel et al (2004) Unpublished
4. Brettin et al (2004) Unpublished
5. K Williams (17-Aug-1999)

Posted: 17-Aug-1999

tmRNA Website ID: Bacil_anthr_0488

[Preceding] [Next] in database