[Preceding] [Next] in database
Bacillus anthracis tmRNA:
. 10 . 20 . 30 . 40 . 50
GGGGACGUUACGGAUUCGACAGGGAUAGUUCGAGCUUAGGUUGCGAGUCG
AGGGGAUCGGCCUCGUUAAAACGUCAAAGCCUAUAAUUGGCAAACAAAAC
AAUCUUUCUUUAGCUGCUUAAUUGCACUAAAGGUUCCUCCCUCCAUCGUC
CAUGUGGUAGGGUAAGGGACUCAAACUAAGUGGACUACGCCGGAGUUCGC
CGUCUGAGGACAAAGGAAGAGAACAACCAGACUAGCAACUUGGAAGCCUG
UCGAUAGGCCGAAGAGUUCGCGAAAUGCUAAUAUAUCGACUACACUCGUA
GAAGCUUAAGUGCCGAUAUUUUUGGACGUGGGUUCGACUCCCACCGUCUC
CACCA
{NOTE: Identical to B. cereus tmRNA version 1 and B. thuringiensis tmRNA version 1}
Proteolysis Tag: (A)GKQNNLSLAA*
Reading Frame (underlined): nt 89-121
Taxonomy: Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae
Sequencing:
Bacillus anthracis str. A2012,
nt 176409-176055 of AAAC01000001.1
(and nt 176409-176055 of NZ_AAAC02000001.1)
[Ref 1];
Bacillus anthracis str. Ames,
nt 4834737-4834383 of AE016879.1
(and nt 4834737-4834383 of NC_003997.3)
[Ref 2];
Bacillus anthracis str. Kruger B,
nt 30182-29828 of AAEQ01000042.1
(and nt 30182-29828 of NZ_AAEQ01000042.1)
[Ref 3];
Bacillus anthracis str. Western North America USA6153,
nt 105304-105658 of AAER01000034.1
(and nt 105304-105658 of NZ_AAER01000034.1)
[Ref 3];
Bacillus anthracis str. 'Ames Ancestor',
nt 4834863-4834509 of AE017334.2
(and nt 4834863-4834509 of NC_007530.2)
[Ref 3];
Bacillus anthracis str. Sterne,
nt 4836072-4835718 of AE017225.1
(and nt 4836072-4835718 of NC_005945.1)
[Ref 4];
Bacillus anthracis str. Australia 94,
nt 28815-28461 of AAES01000020.1
(and nt 28815-28461 of NZ_AAES01000020.1)
[Ref 3];
Bacillus anthracis str. CNEVA-9066,
nt 224470-224824 of AAEN01000018.1
(and nt 224470-224824 of NZ_AAEN01000018.1)
[Ref 3];
Bacillus anthracis str. A1055,
nt 224535-224889 of AAEO01000027.1
(and nt 224535-224889 of NZ_AAEO01000027.1)
[Ref 3];
Bacillus anthracis str. A1055,
nt 53-407 of AAEP01000006.1
(and nt 53-407 of NZ_AAEP01000006.1)
[Ref 3]
Identification: [Ref 5] in A2012 sequence data at TIGR
Reference:
1. Read et al (2002) Science 296:2028-33
2. Read et al (2003) Nature 423:81-6
3. Ravel et al (2004) Unpublished
4. Brettin et al (2004) Unpublished
5. K Williams (17-Aug-1999)
Posted: 17-Aug-1999
tmRNA Website ID: Bacil_anthr_0488
[Preceding] [Next] in database