Acinb_bauma_0650 - Acinetobacter baumannii tmRNA (5-prime end unsequenced)

[Preceding] [Next] in database
Acinetobacter baumannii tmRNA (5-prime end unsequenced):


    .   10    .   20    .   30    .   40    .   50
UGCUGGCGGACGCGGGUUCAACUCCCGCCAUCUCCACCA

Proteolysis Tag: unsequenced

Taxonomy: Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Moraxellaceae

Sequencing:
Acinetobacter baumannii, nt 1-39 of AR319033.1 {Patent: US 6562958-A 1583 13-MAY-2003} [Ref 1]

Identification: [Ref 2] in AR319033

Reference:
1. Breton and Bush (2003)
2. K Williams (18-Feb-2005)

Posted: 18-Feb-2005

tmRNA Website ID: Acinb_bauma_0650

[Preceding] [Next] in database