© 2005 ENSI (Evolution & the Nature of Science Institutes) www.indiana.edu/~ensiweb
This material may be copied only for noncommercial classroom teaching purposes, and only if this source is clearly cited.

 Return to List of Lessons

 Return Home

 

CHROMOSOME
FUSION ?

A DNA APPLICATION:
Hypothesis-Testing

 

Larry Flammer

EVOLUTION:
Human Patterns

NATURE OF SCIENCE
Science Processes
Testing Hypothesis

 NOTICE: A new version of this lesson has been added, called "The Mystery of the Missing Marks." It consists of a PowerPoint program that walks students through the problem-solving process for testing the hypothesis that our #2 chromosome resulted from the fusion of two shorter chromosomes found in chimps. Students search for the telomere DNA in the middle of our #2 chromosome, and FIND it, a real molecular fossil that we all have. This version provides the DNA segment containing the telomere DNA, so there is no need for students to search online databases (preferred, but also a litle tricky and time consuming. Directions for doing that are contained in this Chromosome Fusion lesson).

 SYNOPSIS

The banding pattern of our long chromosome #2 closely matches the banding patterns of two shorter chromosomes found in apes. This suggests the likelihood that our #2 chromosome was formed by the head-to-head fusion (merging) of those two shorter chromosomes in an early human ancestor. To test that hypothesis, students search for evidence of this fusion in the DNA of chromosome #2, using online databases (or printouts of same) to seek the sequences typical of terminal DNA (telomeres). In the process, students see how patterns can reveal events of the past, thereby merging elements of both experimental and historical science. They discover the huge amount of DNA in a chromosome, get a sense of gene size and the number of pseudogenes, correlate visible chromosome bands and their contained DNA, and learn to use an accessible online resource for further study and inquiry.

 PRINCIPAL CONCEPT

Modern apes and humans evolved from a common ancestor.

 ASSOCIATED CONCEPTS

1. The evidence that humans have evolved from non-humans is stronger than that for evolution within most other groups.
2. Many features of modern organisms reflect the structure of their ancestors in ways that are not adaptive.
3. Scientific explanations confirmed by different lines of evidence are stronger, more likely to be accurate.
4. DNA provides a useful record and diagnostic tool to study the ancestry of modern organisms.
5. Hypotheses about past events can be tested by looking for revealing patterns in the present.
6. Genes and pseudogenes are directly accessible on the internet for study and inquiry.

ASSESSABLE OBJECTIVES

   Students will....

1. Given the likely fusion area sequence, students will recognize (correctly identify):
a) the telomere region from one original chromosome
b) the telomere region from the other original chromosome
c) the precise point of fusion (where the telomeres from two chromosomes meet head-to-head)

2. Students will correctly explain the significance of this fusion (in context with other indicators: molecular, banding patterns, fossil comparisons) in terms of biological relationship between apes and humans.

3. Students will demonstrate ability to navigate one of two websites to display the DNA sequence of a desired region in a selected chromosome.

 MATERIALS

Student Handouts (see below)
Teacher Instructions [Click here for this lesson in PDF format (3 pages)]
Likely responses to questions for each Part (available upon teacher request to ENSI webmaster)

ALL MATERIALS ARE IN PDF FILES TO RETAIN THEIR CRITICAL FORMAT. SEE END OF LESSON FOR INFORMATION ON READING PDF FILES.

 TIME

Two 45 minute class periods (or one period, with tightly structured, guided discussion by teacher).
STUDENT HANDOUTS
(see end of lesson for html version of the main Student Handout).
Click on items in BLUE below to download those PDF files.
Chromosome Fusion: I. The Challenge & II. The Search (4 pp). This is the main Student Handout. See HTML version at the end of this lesson.

Appropriate "Search" pages for Part A, Part B, Part C, and/or Part D. [Click here for all 4 Parts in PDF format (5 pp)]. Student copies of Part C would be easier to follow if printed in color. These pages were revised Oct. 2006.

Intro. Fig.: Hominoid Chromosomes: human, chimpanzee, gorilla, orangutan, comparisons, showing banding patterns (preferably used in a chromosome comparison lesson earlier); 1.1 MB file
Fig. 1: Chromosome #2, enlarged, comparing all four species
Fig. 2: Chromosome #2, from NCBI Map Viewer (for paper search)
Fig. 3: Chromosome #2, closeup of fusion region (for paper search)
Fig. 4: DNA Sequence in fusion region (for paper search)
Fig. 5: DNA structure, showing opposing 5' to 3' orientations of its two strands, and deoxyribose structure; 1.6 MB file
(Place Figures in plastic sleeves or laminate for annual reuse)

 

 

TEACHING STRATEGY

WHY YOUR STUDENTS SHOULD DO THIS LESSON:
1. Tests a hypothesis for an observed problem: actually DO real science!

2. Connects the visible (chromosome banding) with the abstract (molecular structure of DNA)

3. Students USE same online tools that scientists use to do bioinformatics!

4. Students SEE the amount of DNA in a tiny segment of DNA in a chromosome.

5. Students discover compelling evidence of our common ancestry with apes.

CONTEXT:
This lesson could be used as an extension of chromosome comparisons in a genetics unit, or as an extension/application in a DNA unit. In either case, it serves especially well as a confirmation of the primate ancestry of humans indicated from the Hominid Skulls lab, Primate Hemoglobin Sequence Comparisons, and/or a Hominid Chromosome Comparison lab, possibly in an evolution unit.

OPTIONAL PATHWAYS: At first glance, this lesson may seem complicated and time-consuming. However, there are five different ways your students can do this lesson, five different pathways following the Observations, Questions, and Possible Explanations (Hypotheses) introduction:
1. Easiest: Students just do Part D (search on paper copy of region of DNA for the tell-tale DNA sequences). This is the quickest and simplest, but also not as impressive or engaging as the other approaches

2. More Time: Students do Part C (online search using the "Sanger" database). This is probably the more direct and colorful entry into a DNA database, with detailed instructions and check-questions along the way.

3. More Time, Using "Blast" Search Tool: Students do Parts A & B (online visual search, followed by a computer search with "Blast", with detailed instructions and check-questions along the way.

4. Teacher Demo: Teacher uses overhead to walk class through Part D, OR uses projector with online computer to walk class through Part C or Parts A & B. Any of these pathways could use the PowerPoint presentation described below to introduce the lesson.

5. Homework Assignment: Students can be asked to do one or two specified parts at home (or on their own time at a library computer, etc.), or it can be offered as an extra credit assignment. Each part is self-instructive.

NEW PowerPoint Presentation for this lesson (Chromosome Fusion?) is now available. This makes a very helpful introuction to the lesson, or could even be used instead of the lesson if time is short (not as good as students doing it themselves, though!) The PPP is presented as an inquiry approach (as is the lesson), and includes results with discussion items. Be sure to use the Script provided with this PowerPoint.

PREPARATIONS:
1. This lesson is most impressive and effective if the students have broadband access to the internet. Complete directions are provided. It could even be done as a homework assignment, required or extra credit. If online access is not available, the "Search" can be done using a printed copy (provided) of a tiny portion of the DNA in our chromosome #2 (Fig. 4). Be sure to have sufficient copies of the student instructions (Challenge, with DNA Details) plus copies of the appropriate "Search" page(s), depending on whether internet access is available, or not. If internet access is available, you have the option of using Parts A and B, or Part C, or all 3; your choice, depending on time available and which you think your students could handle best. Be sure to try all 3 parts (or Part D) yourself before doing this lesson, to help you decide which works best. Part C has two pages; best to print them back-to-back on one sheet/student. Part C would be easier to follow if student copies are printed in color (reflecting colors on website).

2. Provide sufficient copies of the Figures (one set per team, ideally placed back-to-back in plastic sleeves or laminated for easy re-use).

3. Overhead transparencies could be made of Figures 1-5 (plus the Intro Figure) to illustrate a classroom discussion of the process. If you intend to walk your class through the Challenge and DNA Details, you should also have overhead transparencies of the DNA diagram pages. Additional illustrations desired from specific DNA website pages will be emailed to you if you request them from the ENSI webmaster.

4. DNA Models, showing the 5' - 3' distinctions. These would be helpful to show students why the 5' end of one DNA strand can only attach to the 3' end of the DNA strand in the other chromosoeme. One of the best models to show this is the Molymod DNA model. It's detailed enough to convey the essential structure of DNA clearly, with appropriate molecular shapes, yet it doesn't show every atom in the molecule. It's also large and colorful enough to be seen fairly well. The Molymod kit listed below will make two DNA molecules (showing the tandem repeats), each about 10 cm by 29 cm. Click here for photos of these Molymod models of telomeres. It's even more impressive if you can insert the DNA models of the tandem repeats into the ends of a couple lengths (3' - 4') of 4" white flexible dryrer vent duct tubing, marked with black felt pen to mimic the banding patterns of the two short chromosomes in chimps (2a and 2b) that clearly fused to form our #2.

Below are suitable models from 3 vendors (prices as of Sept. 2006):

Carolina Biological Supply:
Molymod DNA Model Set (22 BP, 45 cm tall) #84-0203 $78.50
K'NEX DNA . Set (24 BP, 521 pieces) #21-1119 45.00
DNA & Molecular Model Kit (8 BP/kit) #17-1056 17.50 x 2 = $35

Ward's Natural Science:
DNA SuperModel Kit (12 BP) #81V7100 23.95

Science Kit & Boreal Labs:
Boreal DNA Structure (8 BP/kit) #WW4538051 14.95 x 2 = $29.90

 

 

PROCEDURES

 

1. INTRODUCTION (Read this to students):
When a bullet is suspected of being fired from a particular gun, its rifling marks can be compared to those on a known bullet fired from the suspected gun. If the bullet mark patterns match closely, this is strong evidence for their common origin (from the same gun). In like fashion, when the banding patterns of two chromosomes match closely, their common origin is strongly confirmed. Furthermore, similar DNA sequence patterns provide additional evidence for common origins. This lesson will allow you to further test the primate ancestry of humans.
[This is MUCH MOR IMPRESSIVE if the students actually DO the bullet-comparison activity in "Chromosome Connection 2." At the very least, demonstrate that activity on your overhead or PowerPoint system.]

2. If students haven't seen (in an earlier lesson on chromosome comparisons) the page showing the banding patterns for all the chromosomes of humans and apes, be sure to show this to them (Intro Figure), either in a handout, or on your overhead projector. Tell them that these are banding pattern diagrams of the chromosomes from 4 different species of animals. Ask them what they see as most striking about the page... what stands out? [Hopefully, they will notice the strong similarities in banding patterns between the species]. Then point out that the first chromosome in each set is human, the second is from a chimp, the third is from a gorilla, and the fourth is from an orangutan.
3. Eventually, (if not mentioned by students) draw attention to our chromosome #2, where it matches a combination of two shorter chromosomes in the apes; (apes have 24 pairs of chromosomes, while we have 23). At this point, students should read the Chromosome Fusion Challenge.
4. Students should be able to proceed largely on their own (working alone, in pairs, or small teams, as you prefer), following the directions given, using the figures provided, and answering questions in their notebooks or on a separate sheet of paper. In some classes, you might prefer to walk them through the lesson, at least through the Challenge and DNA Details, displaying the DNA sequences for discussion, then let them do the Search activity working in pairs at computers (or the paper version, Part D, if they have no internet access). Students should answer questions on the pages for the Part(s) of the Search on which they are working. This should be followed by guided class discussion of their answers. Expected responses are available if you request them from the ENSI webmaster using your school email address.

5. It may help students to understand the 5' to 3' union requirement for fusion if you use a DNA model

ATTENTION: Sometimes, websites make changes. If you or your students find that the website pages don't seem to fit or respond to the descriptions in our directions, possibly, you (or clever students) can adapt to the changes and figure out how to accomplish the essential tasks critical to this lesson. ENSI has no control over the changes in other websites. In any case, let the ENSI webmaster know, and the directions will be revised to fit the changes and uploaded to the ENSI website. You will be notified when this has been done. A case in point: during the development of this lesson, the Sanger site made major changes to its pages, requiring major revisions to our directions. It does happen!

ASSESSMENT

[sample assessments, questions, are welcome, based on the Assessable Objectives (above); please send to ENSI webmaster to share on site]

 

 

EXTENSIONS

& VARIATIONS   

1. A challenging extension would be for students to seek the DNA sequences at the ends of chromosomes, to confirm that they indeed show the same tandem repeats for telomeres as indicated in the existing lesson. In fact, if time allows, this could be an interesting "discovery" activity to precede this "Chromosome Fusion" lesson. The Sanger Genome Browser site (see Part C) would probably work best for doing this search. However, be forewarned that the downstream telomeres (at the lower ends of the q arms) lack around 100-200,000 basepairs due to the lack of contigs for those ends.

2. Another easy extension (added 6/15/2006) involves the search for evidence of the second (upper) centromere. In the process, students experience examples of Fair Tests and MILEs (Multiple Independent Lines of Evidence). Click Here for a little worksheet that does this, and refers to a News Release that reports on that second centromere.

3. Experience with this lesson could encourage students to explore other lessons that utilize online DNA and protein analyzing programs, e.g., the Tutorial: Investigating Evolutionary Questions, and Using Online Molecular Databases. These programs will further enrich student understanding of evolution and the nature of science.

4. OTHER LESSONS: If not already studied, students should also work with the following lessons on this site, providing Multiple Independent Lines of Evidence deeply reinforcing the concept that humans and apes share a common ancestry:
Comparison of Hominid Chromosomes (this, or the Chromosome Connection lesson should precede the Chromosome Fusion lesson).
Chromosome Connection (at www.becominghuman.org > Learning Center > Lesson Plans)
Chromosome Connection 2 (revised, improved version, on site)
Hominid Cranial Comparisons (Skulls Lab)
Chronology Lab
Molecular Sequences & Primate Evolution
Footsteps in Time: the Laetoli Trackway

NOTE: NEW PRIMATE TAXONOMY - Due to molecular and genetic studies, the African apes are now placed in the same family (hominids) as humans, and humans have been moved into the subfamily "hominins". Click here for details of this revised taxonomy.

  RESOURCES

"Comparison of the Human and Great Ape Chromosomes as Evidence for Common Ancestry" by Robert Williams, from The Evolution Evidence Page at http://www.gate.net/~rwms/EvoEvidence.html

You will find additional, very useful references on that page, particularly...
"Gene Content and Function of the Ancestral Chromosome Fusion Site in Human Chromosome 2q13-2q14.1 and Paralogous Regions" by Yuxin Fan, Tera Newman, Elena Linardopoulou, and Barbara Trask. Genome Research, 2002 Nov., 12(11): 1663-72

Chromosomal Speciation Models: ENSI Co-Director, Craig E. Nelson responds to questions about "How does the first chromosome change get passed along to future generations?" Explanations and resources are offered.

 ATTRIBUTION

Some of the ideas in this lesson may have been adapted from earlier, unacknowledged sources without our knowledge. If the reader believes this to be the case, please let us know, and appropriate corrections will be made. Thanks.

This lesson was developed in July, 2005 by Larry Flammer, ENSI webmaster. It was inspired by the Evolution Evidence Page by Robert Williams (see Resources above).

Many thanks to scientists Yuxin Fan and Barbara Trask (authors of referenced article) for their generous help in accessing the fusion regions online, and doing a Blast search.

Also, thanks to Kevin Flammer and Steven Flammer for beta testing an early draft. Their suggestions were very valuable, leading to a complete re-write of the lesson.


 The following is an HTML version of the Student Handout, without the Figures. These are all available in PDF format from the list of MATERIALS above.

CHROMOSOME FUSION
I. THE CHALLENGE
A. OBSERVATIONS
1. Observe the human Chromosome #2 and the matching ape chromosomes (Fig. 1). The constriction (narrowing) just above the middle of our chromosome 2 (Hu) is called the centromere. The shorter segment of the chromosome (above the centromere constriction) is called the "p" arm; the longer portion (below the centromere) is called the "q" arm. Each arm is divided into numbered regions and sub-regions, and within each sub-region, the dark and light bands may be further identified by decimal numbers. The identification number (ID) for any particular band is a combination of these letters and numbers. For example, the lowest tip end band of chromosome #2 is: 2q37.3. Be sure to confirm that on Fig. 1.

2. Notice the identical banding patterns between the corresponding arms of the human (Hu) and the two chimpanzee (Ch) chromosomes. Our "p" arm is nearly identical to the chimp's upper chromosome, and our "q" arm is nearly identical to the chimp's lower chromosome.

3. Look carefully at the region near the middle of our chromosome 2 that corresponds to where the tip ends of the two matching chimp chromosomes overlap and where the bands are not identical to those in our chromosome 2. Do you see the white band located there, labeled 2q13?

B. INTERESTING QUESTION: Why does our chromosome #2 appear to be so very similar to the two shorter chromosomes found in apes (chimpanzees, gorillas, and orangutans)?

C. SOME POSSIBLE EXPLANATIONS (Building a Working Hypothesis):
1. They were designed that way.
2. Chromosome 2 split into two (fission) in the ancestral branch (or branches) that produced the apes.
3. Chromosome 2 formed from the joining (fusion) of two shorter chromosomes in an early human ancestor after the apes branched off.

To suggest "design" as an explanation usually implies a supernatural designer, and since supernatural forces cannot be reliably tested or disproved (basic requirement for all scientific explanations), "design" cannot be properly considered as a scientific explanation.

Other studies (fossil and molecular) have suggested that the gorillas and orangutans apparently branched off (from an evolutionary line leading to humans) earlier than when the chimps branched off. So explanation #2 (above, identical fissions) would have been required to happen 3 times independently, and this is very unlikely.

That leaves explanation #3, namely that human chromosome #2 probably resulted from the head-to-head fusion (joining) of those two smaller chromosomes in an early human ancestor after the apes branched off. This is the hypothesis that we will be testing. We will want to look for evidence of that ancestral fusion in our current chromosome #2.

D. DNA DETAILS DETOUR: If you are unfamiliar with details of chromosome orientation, chromosome telomeres, telomere structure (and variations), 5'-3' and 3'-5' orientations of the parallel strands of a DNA molecule, and the only way two DNA molecules can join, study the DNA DETAILS beginning on page 3, then return to this point to continue.


E. PREDICTION: If fusion happened, there should be evidence of the two telomeres from the two ancestral chromosomes in that apparent fusion region (2q13) near the middle of our chromosome #2. If we can find the DNA sequences of two sets of head-to-head telomeres in the suspected fusion region, this would provide strong evidence that our chromosome #2 was indeed formed from the head-to-head fusion of two shorter chromosomes from our earlier ancestry (the same two chromosomes we find separately today in the apes). The existence of head-to-head telomeres mid-chromosome would otherwise be hard to explain. This evidence further strongly confirms a close kinship of humans and apes.

F. THE TEST: To test our selected hypothesis, you will need to search the suspected fusion region in chromosome 2 for evidence of head-to-head telomeres. If that evidence is found, our hypothesis is strengthened. If evidence is not found, the hypothesis may not be correct.

 

II. THE SEARCH
DO ONE OR MORE OF THE FOLLOWING SEARCHES
IF YOU HAVE INTERNET ACCESS: Do Part A (below) to get oriented to the region of interest in chromosome #2, and to get a working sense of the vast amount of DNA there, and how difficult it is to find a particular sequence. You shouldn't spend more than about 5minutes searching. At that point, you should either go on to Part B to do the BLAST2 search, or (if assigned) do Part D to search the printed copy of DNA in the fusion region. If you have time (or for homework) do Part C, which will take you to a fascinating discovery.

IF YOU DO NOT HAVE INTERNET ACCESS: Do Part D. You will need to get copies of all the Figures, along with a copy of Part D directions.

PART A. VISUAL SEARCH ONLINE with NCBI
Uses the NCBI website, with its great visual maps showing locations from which the many cloned segments were taken, along with detailed DNA sequences arranged in rows (as used in this lesson): http://www.ncbi.nlm.nih.gov/mapview/maps.cgi.

PART B. SEARCH WITH the "BLAST2" SEARCH TOOL on NCBI
This is one of the online tools that scientists use to look for specific sequences. It involves entering a short search sequence "probe" and specifying the DNA region to search.
http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi

PART C. SEARCH on the SANGER GENOME BROWSER
The Sanger Institute (Human Genome Browser: e! Ensembl Human), shows the linear arrangement of DNA, with each nucleotide in a different color, plus the complementary matching sequence, and all the possible amino acids coded for. Very colorful: http://www.ensembl.org/Homo_sapiens/index.html.

PART D. PAPER SEARCH on the ONE-PAGE COPY OF DNA in the FUSION REGION
If online access is not available, use the provided page showing the DNA sequence copied from the tiny portion of the 2q13 region where telomere fusion should be found.

 

GO TO THE PAGE WITH THE PART YOU WILL BE WORKING ON


DNA DETAILS

DNA STRUCTURE
1. As you probably remember from your earlier studies, DNA is a double-stranded ladder-shaped molecule (when it's untwisted from its normal helix shape). In addition, you should recall that each "rung" of the ladder consists of a "base-pair" of two nucleotide bases, with only the following pairings: t&a, a&t, g&c, or c&g. The sample below shows these pairings:
ttagggttagggttagggttagggttagggttagggttaggg Strand 1
||||||||||||||||||||||||||||||||||||||||||
aatcccaatcccaatcccaatcccaatcccaatcccaatccc
Strand 2

2. Since each letter in strand 2 can be inferred (and assumed) from its matching letter in strand 1, we often just work with one strand to keep it simpler and take less space, as shown below:
ttagggttagggttagggttagggttagggttagggttaggg Strand 1

However, each letter (base) in strand 1 may still be called a "base-pair" (bp), reflecting the fact that it represents a matched pair of bases at that position in the complete DNA molecule.

3. By the way, do you see the repeating pattern in that sequence? If not, try saying the letters in that sequence out loud. You should see that the sequence ttaggg repeats over and over again. These are called "tandem repeats." In order to clarify this pattern, we can insert a break between each set (although, in reality, there are no breaks), so strand 1 would look like this:
ttaggg ttaggg ttaggg ttaggg ttaggg ttaggg ttaggg
This particular series of tandem repeats (of these six bases, usually repeated 800 to 1600 times), is always found at both ends of every chromosome. These "end pieces" of DNA, called "telomeres," are like the ends of shoelaces, keeping the chromosome ends from "unraveling" or getting damaged.

4. In reality, these sequences may vary slightly, especially as the telomere region comes closer to the non-telomere DNA. For example, part of the sequence might look like this:
ttaggg ttaggg ttgggg ttaggg ttgggg ttgggg ttgggg
See the differences? In any case, the most characteristic feature of a telomere is its many, many repeats of 3-4 g's at a time, and virtually no c's in that strand. Take another look at the sample to confirm this.

DNA ORIENTATION
5. In order to understand what you will be seeing in the real DNA sequences while looking for evidence of fusion, you need to recognize how the two strands in DNA are oriented relative to each other, and how this orientation relates to our conventional orientation of chromosomes.

6. Chromosomes in a karyotype (total chromosome array for a species) are typically oriented with their centromeres above the midpoint of each chromosome (somewhere between the midpoint and the end of the shortest arm, which we call the "p" arm); see the Introductory Figure, showing the karyotypes of humans (properly oriented) and 3 ape species, side by side for each corresponding chromosome, oriented to show closest matching. The uppermost end of each human chromosome (with the shorter, or p, arm) is called the "head end."

7. The single DNA molecule in each chromosome is, of course, composed of two parallel strands, held together by the hydrogen bonds between its matching base pairs. Something you may or may not have learned is that one strand is oriented upside down relative to the other. The deoxyribose sugars in both strands are comprised of carbon atoms numbered from one to five. See Figure 5. When the number 5 carbon attaches to the phosphate group above it, and the number 3 carbon connects to the phosphate below it, we say that it is oriented 5' to 3' (5 prime to 3 prime). This is the orientation of strand 1. Its companion strand (strand 2), is oriented oppositely: 3' to 5'. The matching bases require this opposing orientation in order to bond properly to each other, holding the two strands together.

8. When you look at the two chimpanzee chromosomes that match our chromosome #2, notice (in Fig. 1) that the upper chimp chromosome (we'll call it the "p" chromosome) is "upside down" (its centromere is near its lower end), and the lower chimp chromosome ("q" chromosome) is "right side up" (its centromere is near its upper end). Therefore, if those two chromosomes joined together to make our chromosome #2, they must have joined "head to head." Study Fig. 1 carefully to verify that.

9. However, it's important to note that strand 1 in the head end of the upper (p) chromosome (the 5' end) cannot join with strand 1 in the head end of the lower (q) chromosome (also its 5' end). Due to their structural chemistry, a 5' end cannot join with another 5' end:

 Head end of the upper chrom.
gggattgggattgggattgggatt5'
||||||||||||||||||||||||
ccctaaccctaaccctaaccctaa
3'

Head end of the lower chrom.
5'ttagggttagggttagggttaggg
..
||||||||||||||||||||||||
3'aatcccaatcccaatcccaatccc


Fusion can't happen here: the two 5' ends can't join each other, and neither can the two 3' ends.

10. But, with a half twist, the 5' end will meet and join the 3' end in the other chromosome, and likewise for the other two strands:

 Head end of the upper chrom.
gggattgggattgggattgggatt5'
||||||||||||||||||||||||
ccctaaccctaaccctaaccctaa
3'

Head end of the lower chrom.
3'aatcccaatcccaatcccaatccc
..
||||||||||||||||||||||||
5'ttagggttagggttagggttaggg



A useful analogy could be the way 4 rectangular magnets would behave. Color the North poles of each magnet red (=5'), and the South poles blue (=3'). When two are brought side-by-side, red and blue ends are attracted. When the two pairs are now brought end-to-end, each red end (5') attracts a blue end (3').

11. When those telomere ends join together, we see the following. In your notebook, complete the diagram by showing the missing letters that would be on the line (do not write on this sheet):
gggattgggattgggatt__________________
||||||||||||||||||||||||||||||||||||
ccctaaccctaaccctaattagggttagggttaggg

12. Looking at just one strand again, for simplicity, this is how the 5' head end of the upper (p) chromosome, when fused to the 3' head end of the lower (q) chromosome, would appear:
gggattgggattgggattaatcccaatcccaatccc
What is the most obvious difference you see as you go from the left, past the fusion point, and on to the right? (answer this in your notebook)

13. Using the slightly modified sequences (more typical), the fusion point can also look like this:
gggattggggttggggttaatccccatccccatccc
Notice how this even exaggerates the obvious pattern of many multiple g's followed by many multiple c's. This is what you will want to look for in your search.

RETURN TO "PREDICTION" ON PAGE 2

 All materials are in Adobe Acrobat pdf format in order to maintain their intended layout (see Materials). To access all pages (for printing and copying), you will need to download the free Acrobat Reader from Adobe (unless it's already installed in your system).

 

Return to Top of Page

 Home

 Return to List of Lessons